Python package for writing and reading a local collection of
Project description
biocommons.seqrepo
Python package for writing and reading a local collection of biological sequences. The repository is non-redundant, compressed, and journalled, making it efficient to store and transfer multiple snapshots.
Released under the Apache License, 2.0.
Features
Timestamped snapshots of read-only sequence repository
Space-efficient storage of sequences within a single snapshot and across snapshots
Bandwidth-efficient transfer incremental updates
Fast fetching of sequence slices on chromosome-scale sequences
Precomputed digests that may be used as sequence aliases
Mappings of external aliases (i.e., accessions or identifiers like NM_013305.4) to sequences
The above features are achieved by storing sequences non-redundantly and compressed, using an add-only journalled filesystem structure within a single snapshot, and by using hard links across snapshots. Each sequence is associated with a namespaced alias such as <seguid,rvvuhY0FxFLNwf10FXFIrSQ7AvQ>, <ncbi,NP_004009.1>, <gi,5032303>, <ensembl-75ENSP00000354464>, <ensembl-85,ENSP00000354464.4> (all of which refer to the same sequence). Block gzipped format (BGZF)) enables pysam to provide fast random access to compressed sequences.
For more information, see doc/design.rst.
Anticipated deployments
Local read-only archive, mirrored from public site, accessed via Python API
Local read-only archive, mirrored from public site, accessed via REST interface (not yet available)
Local read-write archive, maintained with command line utility and/or API
Requirements
Reading a sequence repository requires several packages, all of which are available from pypi. Installation should be as simple as pip install biocommons.seqrepo.
Writing sequence files also requires bgzip, which provided in the htslib repo. Ubuntu users should install the tabix package with sudo apt install tabix.
Development and deployments are on Ubuntu. Other systems may work but are not tested. Patches to get other systems working would be welcomed.
Quick Start
On Ubuntu 16.04:
$ sudo apt install -y python3-dev gcc zlib1g-dev tabix $ pip install seqrepo $ rsync -HRavP rsync.biocommons.org::seqrepo/20160828 /usr/local/share/seqrepo/ $ seqrepo -d /usr/local/share/seqrepo/20160828 start-shell seqrepo 0.2.3.dev2+neeca95d3ae6e.d20160830 root directory: /opt/seqrepo/20160828, 7.9 GB backends: fastadir (schema 1), seqaliasdb (schema 1) sequences: 773511 sequences, 93005806376 residues, 189 files aliases: 5572724 aliases, 5473237 current, 9 namespaces, 773511 sequences In [1]: sr["NC_000001.11"][780000:780020] Out[1]: 'TGGTGGCACGCGCTTGTAGT'
See Installation and Mirroring for more information.
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file biocommons.seqrepo-0.2.3.post2.tar.gz.
File metadata
- Download URL: biocommons.seqrepo-0.2.3.post2.tar.gz
- Upload date:
- Size: 40.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 | c45ea6b301c82fdcf90194a637e9f36a8cdb5889a37d8b67c5b5534e430bc81b |
|
| MD5 | 0c181cef8073857d59e45ff81b3dafc6 |
|
| BLAKE2b-256 | 830383961b64dca6bcc802f42dfb641e3f9a8a3448cfc1b853d8d8dc93ff7a82 |
